Biology Final Exam

Card Set Information

Author:
iloveyoux143
ID:
189143
Filename:
Biology Final Exam
Updated:
2012-12-14 23:32:33
Tags:
Freshman Biology
Folders:

Description:
Test of 12/15/12
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user iloveyoux143 on FreezingBlue Flashcards. What would you like to do?


  1. Be able to draw a DNA molecule
  2. What are genes made of?
    Genes are on chromosomes which are made of DNA and protein, so genes must be either DNA or protein
  3. What did Hershey and Chase do?
    • found when they made a protein radioactive, the cell wall was radioactive too
    • found that radioactive protien was not necessary for replication
    • --> you need genetic blueprint-->DNA
  4. What is DNA? Who discovered it?
    • Deoxyribonucleic Acid
    • Watson, Crick and Roselin Franklin discovered it
  5. What is DNA made up of?
    • Made up of deoxyribose sugar (which has an oxygen removed at the 2'
    • carbon on the structure while ribose has oxygen and hydrogen bonded to
    • all carbons), phosphate(negatively charged) and bases
    • the 5' and 3' carbons are attached to a phosphate
  6. What are the DNA bases and which ones go together?
    Include sizes
    • Adenine(larger) & Thymine (smaller)
    • Cytosine (smaller) & Guanine (larger)
  7. Why do only A and T and Cand G go together?
    • a big base can only bind with a little base and a little base can only bind with a big base
    • Only G and C can hydrogen bond correctly together (G and T cant theyll have 2 positve charges repeling instead of a pos and neg connecting) same with A and T
  8. What do genes do?
    Determine the amino acid sequence of the protein
  9. Are the bases attached to the sugar or the phosphate?
    the SUGAR
  10. Dna directional structure?
    • 5'-----------------------------> 3'
    • 3'<----------------------------- 5'
  11. What did Watson and Crick find about DNA containing only A-T and C-G pairs
    • 1. only small and large fit together
    • 2. only A-T and C-G pairs will hydrogen bond correctly
    • 3. Although there may not  be an even amount of each base pair in DNA, the # of As always = the # of Ts and the #of Cs always = the # of Gs, proving that they pair
  12. If Thymine makes up 21% of DNA, what is the % of Gs?
    • 21% T means 21% A= 42%
    • 100%-42%= 58% / 2
    • = 29% G
  13. Is DNA an acid or base? How is it neutralized?
    • Acid
    • positively charged ions (ex: magnesium) and nucleosomes neutralize it
  14. What are nucleosomes?
    • Nucleosomes are formed when 8 histones combine and bind to DNA
    • DNA wraps around histones and the whole structure is called a nucleosome
  15. What are histones?
    • histones are like small positively charged barrel like structures on a negatively charged string of DNA
    • the addition of groups (molecules) to histones can ultimately determine if the DNA can make a protein
  16. Why can 6ft of DNA fit in the nucleus?
    bc nucleosomes condense to form chromatin
  17. Is DNA always organized into chromosomes?
    No, only during cell division
  18. W/ the DNA packaged so tightly, how do enzymes get in?
    through chemical modification of histones
  19. How does DNA replication happen?
    • DNA is pulled apart, then you have enzymes that if they see an A will attach a T etc,
    • it would take very long if replication started at 1 end of DNA and went all the way so it starts at many different points forming rplication bubbles which eventually meet and the original and new strands are whole
    • new base pair formation
  20. What are single stranded binding proteins
    porteins that keep the hydrogen bonds on the DNA bases from coming back together after helicase unwinds the DNA
  21. How does new base pair formation happen?
    • new base attached with 3 phosphates attached to it (high energy). when
    • attached 2 phosphates come off releasing energy and the  last P replaces the H in the OH on the end of the backbone and the P will bond with the O---> the phosphates coming off provide the energy for biosynthesis
  22. Can DNA polymerase just start adding bases anywhere?
    • no, it cannot just start adding bases from scratch it can only add bases onto an already started strand
    • however RNA polymerase can start from scratch using a primer. in okazaki fragments, once the primer is layed down then the DNA polymerase can start adding then when the polymerase jumps backs and adds DNA, the DNA replaces the RNA primer (an enzyme takes out RNA and puts in the equivelent DNA bases) then ligase attaches the final DNA pieces
  23. In synthesis of DNA or RNA, what end of DNA are new base pairs ALWAYS added to?
    the 3' end
  24. What are the 2 strands during DNA replication?
    • leading strand
    • lagging strand
  25. How do the leading and lagging strands replicate?
    • Leading strand (builds off 3' open end of original strand): adds base pairs continuously as the DNA unravels
    • Lagging strand: enzymes add bases then back up and add then back up and ad creating fragments of DNA called Okazaki fragments
  26. What is the genetic code?
    • 3 bases correspond to one amino acid
    • before the singlet code ( one base corresponds to 1 amino acid) and the doublet code (2 bases-amino acid) were thought but both wrong
  27. What is the start codon? all proteins start with this sequence
    • AUG of ATG
    • codes for MET amino acid "start"
  28. What is Uracil? (U)
    Very similar to thymine. binds to A in RNA
  29. What is the template and sense strand?
    • Template strand: strand being transcripted
    • Sense strand: identical to mRNA except Us are Ts
  30. What is the amnio acid sequence if the top strand is the sense strand?
    5' AAATGCCGATACC 3'
    3' T TTACGGCTATGG 5'
    • 1. look for start "ATG"
    • 2. use chart
    • Met Pro Ile CC...
  31. Can DNA directly be involved in making proteins? why?
    • no
    • bc some cells (ex: Red blood cells) lack DNA but synthesize protein
    • DNA is found in the nucleus, proteins are made on ribosomes in the cytoplasm
  32. How is a protein made then?
    DNA--> transcription--> mRNA-->translation--> protein
  33. Differences between DNA and RNA?
    • Deoxyribonucleic Acid vs Ribonucleic acid
    • DNA sugar is deoxyribose while RNA sugar is ribose
    • DNA bases: ATGC  RNA bases: AUGC
    • DNA double stranded while RNA single stranded
    • DNA long ( a single chromosome may be 100million base pairs long) while RNA varies from 1,000 bases to tens of thousands of bases
    • DNA has structural genes that cary introns (non coding parts) while in RNA introns are cut out
    • DNA has promoters, enhancers, structural genes while RNA only has structural genes
    • DNA replicates while RNA does not (except RNA viruses)
  34. On what side of the mRNA are bases added during transcription
    the 3'
  35. What does RNA polymerase do?
    • catalyzes transcription. DNA unwound in the promoter region and this happens
    • always adds bases in the direction that the DNA is opened
  36. Template strand below. what is the sense strand and mRNA strand?
    5' ACATGCCATTTTACGAGGTACG 3'
    where is the start codon
    • sense strand:
    • 3' TGTACGGTAAAATGCTCCATGC 5'
    • mRNA strand:
    • 3' UGUACGGUAAAAUGCUCCAUGC 5'
    • start codon highlighted
  37. How do you go from a codon to an amino acid?
    What brings the amino acid closer to the codon?
    tRNA attaches the codon to the amino acid with adapting sites.
  38. What does ligase do?
    • sews up ends of okazaki fragments
    • its an enzyme
  39. What enzyme unwinds DNA?
    Helicase
  40. What is DNA polymerase?
    • enzyme that is very precise when copying and has a proof reading mechanism so if a wrong base is inserted the polymerase removes it, backs up and inserts the correct base
    • HIVs polymerase lacks the proofreading mechanism which is why it mutates so much
  41. What can UV light do?
    cause adjacent Thymines to bend and attract to eachother disconnecting from their Adenines and creating a bump in the dna.
  42. What are the 3 types of RNA?
    • mRNA- transcription
    • rRNA - peptide bond formation
    • tRNA- translation
  43. What are transcription factors?
    transcription factors are proetins which attach to DNA and determine if, when and how much a gene is transcribed.
  44. What is an example of a transcription factor?
    NF-kB
  45. What is NF-kB
    • a transcription factor that exists in your cells in an "off" state but when activated, turns on adhesion molecules, MHC proteins, integrins, cytokines, chemokines, and a whole family of proteins in your immune system.
    • triggers genes to be transcripted that code for these proteins
  46. What do integrins/selectins do?
    allow white blood cells to move into affected tissues
  47. What do cytokines do?
    boost immue responses, cause inflammation
  48. What are chemokines?
    chemical attractants for white blood cells
  49. What are MHC proteins
    proteins that facilitate immune attack on foreign molecules
  50. What are the triggers for NF-kB ?
    • bacteria
    • fungi
    • viruses
    • tumors
    • injury
  51. Is NF-kB always helpful? why?
    not always. steroids are used to block it when you dont want immune responses such as in organ transplants
  52. What cells do not have DNA
    Red blood cells
  53. Where is the startpoint for RNA transcription
    • the promoter
    • genes have promotors with TATA regions that bind transcription factors and allows the RNA polymerase to attach to the DNA
  54. What are the steps of transcription?
    • 1. RNA polymerase binds to the promoter sequence preceding start site on DNA ( it lands next to the promoter and makes mRNA until it reaches the stop sequence)
    • 2. RNA polymerase "melts" the DNA and initiates RNA synthesis
    • 3. The polymerase moves downt eh DNA adding bases to the 3' end of the mRNA and transcription continues until it reaches the stop sequence and falls off
  55. What is a promoter?
    a DNA sequence not made into proein but recognized by a protein and proteins that recognize promotors and control transcription are transcription factors
  56. What is RNA processing?
    conversion of pre messenger RNA to mature messenger RNA that is ready to leave the nucleus (pre mRNA cant leave)
  57. What are the steps of RNA processing?
    • 1. a cap is attached to the pre- messenger RNA (same sequence as DNA) to stabilize it
    • 2. RNA splicing
    • 3. Polyadenylation- a tail of adenine bases 
  58. What is RNA splicing?
    The splisosome comes in and cuts out the introns (parts of the sequence with useless codes) and splices the exons togetehr
  59. What is the benefit of splicing in RNA processing?
    the useless parts are taken out
  60. Explain hybridization
    • Heat breaks hydrogen bonds of bases while when cooled they will snap back togther.
    • The RNA will bind to DNA and push away the other DNA strand
    • premature mRNA repels full strand because it is the same sequence while mautre mRNA will have some parts of both DNA strands bact together because introns have been cut out
  61. What are reading frames
    • the set of 3 bases that form a codon and where they are located
    • the end codon must be in the same reading frame arrangement as the start codon 111, 1  11, or 1   11
    • if you add or subtract 1 or 2 bases all reading frames will be thrown off coding for completely different amino acids but if you add or subtract 3 the whole sequence will not change
  62. What is a spliceosome
    protein/rna "organelle" which removes introns from pre-RNA and splices exons together
  63. What is alternative splicing
    after the introns are removed, not all the exons are spliced together. instead of exons 1,2,3,4,5 you might have exons 1,2,3,5 spliced together
  64. What is a real life example of alternative splicing
    • B cells produce antibodies. Resting b cells make antibodies that fit in the membrane (called surface antibodies)
    • when a b cell is activated by an antigen, the b-cell starts secreting antibodies (released into the blood to fight the virus). 
    • Membrane and secreted antibodies are identical EXCEPT membrane antibodies are longer by about 20 amino acids than the secreted antibodies allowing it to stick in the membrane. This is because the secreted antibody is missing one of the exons due to alternative splicing
  65. What does tRNA do?
    • attaches/adapts codon to amino acid
    • only certain amino acids will attach to certain tRNA through specific amino acid attachment sites
    • the conformation of tRNA is similar to that of a protein bc its conformationcan be recognized by an enzyme
  66. what enzyme joins a specific amino acid to tRNA
    • amnoacyl tRNA synthetase
    • also joined by ATP
  67. What is translation
    protein synthesis
  68. What are the RNA molecules
    • mRNA: used for protein synthesis
    • rRNA: structural part not converted to protein, has enzyme activity, catalyzes biochemical reaction
    • tRNA: acts as an adaptor adapting amino acids to codons
    • other RNAs: ex parts of splicosome iRNA interference RNA, cells produce thier own iRNA molecules and there is lab iRNA
  69. What is RNA polymerase
    • the enzyme that transcribes DNA into RNA
    • or the enzyme that synthesizes (produces) RNA
  70. Outlined steps of transcription and translation
    • DNA is transcribed into pre-mRNA
    • Pre-mRNA is edited (processed) to give mature (complete) mRNA
    • mRNA moves from nucleus to cytoplasmic ribosomes
    • mRNA is transcribed into protien by ribosomes
  71. What are bacterial ribosomes 70s made of?
    • 50s Large subuinit
    • 30s Small subunit
  72. What are eukaryotic ribosomes 80s made of?
    • 60s Large subunit
    • 40s Small Subunit
    • some molecules such as streptomycin that harm bacterial ribosomes and help eukaryotic ribosomes and molecules that do the opposite.
    • not all antibiotics attack ribosomes, some attack cell walls, etc
  73. What are the steps of protein synthesis
    • 1. initiation
    • 2. Elongation
    • 3. Termination
  74. What are the steps of initation?
    • 1.small riobsomal subunit captures mRNA
    • 2. 1st charged tRNA binds (by hydrogen bonds) to the start codon
    • 3. large ribosomal subunit joins to form the complete ribosome
    • the part before the start codon helps with attaching to small ribosomal subunit
    • initiation happense only once then onto elongation
  75. What happens in elongation
    • elongation happens as many times as there are amino acids
    • 1. Codon recognition: an incoming aminoacyl tRNA binds to the codon in the A cite
    • 2. Peptide bond formation: the ribosome catalyzes the formation of a peptide bond between the new amino acid and the carboxyl end of the growing polypeptide
    • 3. Translocation: the tRNA in the A site is translocated to the P site (to the left) taking the mRNA along with it. Meanwhile the tRNA in the P site moves to the Esite (exit) and is released from the ribosome. In translocation, the mRNA shifts its position on the ribosome by one codon.
  76. What is the order of the cites in elongation
    E P A
  77. What are the steps of translocation?
    • 1. release factor recognizes the stop codon
    • 2. Release factor releases the protein, tRNA
    • 3. Ribosomal subunits fall off of mRNA
  78. What is a polysome
    mRNA with ribosomes attached inicating that the mRNA engaged in protein synthesis
  79. How many ribosomes can translate a single mRNA molecule at a time?
    several
  80. What are the 2 categories of ribosomes?
    • free ribosomes
    • bound ribosomes- bound to E.R.
  81. Where do ribosomes made in cytoplasm go? Ribosomes made in the E.R?
    • cytoplasm: go into the cytoplasm and some organelles
    • E.R. go inside the E.R. then come out to go to their destination
  82. Know signal mechanism slide
    :)
  83. Proteins have to end up in different places: cell membrane, lysosomes, exported out of cell, mitochondria, cytoplasm, golgi apparatus, etc. How do these proteins know where to go?
    they have localiztion signals in their genes
  84. What is a missense mutation?
    one of the RNA bases is substituted for another causing a change in an amino acid
  85. what is a silent mutation?
    change in base but no change in amino acid sequence
  86. What is a nonsense mutation
    a mutation by insertion deletion or substitution that causes a stop codon to form when it is not supposed to
  87. What is a frameshift mutation
    • adding/deleting 1 or 2 bases shifting the reading frames and changing likely all amino acids after the shift
    • can cause immediate nonsense if added base(s) codes for a stop amino acid
    • insertion or deletion of 3 bases causes no extensive frameshift because codons have 3 bases.

What would you like to do?

Home > Flashcards > Print Preview