Genetics quiz for review

Card Set Information

Author:
zzto
ID:
205203
Filename:
Genetics quiz for review
Updated:
2013-03-05 18:28:16
Tags:
Genetics quiz review
Folders:

Description:
Genetics quiz study
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user zzto on FreezingBlue Flashcards. What would you like to do?


  1. 1
  2. Amino acids are linked together by ______________ bonds to form proteins.
    Answer     B.  peptide
  3. It has been hypothesized that the complexity of human physiology can be explained in part by
    the large proportion of genes that undergo alternative splicing.
  4. Which of the following list of eukaryotic DNA elements places them in the correct order from the 5' to the 3' end of the non-template (coding) strand of DNA?
    promoter,  +1,  AAUAAA, terminator
  5. The +1 site of a transcription unit indicates:
    D.  the first nucleotide to be transcribed in the RNA coding region.
  6. 5' AAACGTA 3' In which direction (right to left, or left to right) will the transcription bubble move?
    right to left
  7. The "degeneracy" of the genetic code refers to the fact that one codon can code for as many as four different amino acids.
    False
  8. Transfer RNA forms several double-stranded loops.
    True
  9. Which of the following RNA nucleotide sequences is most likely to form a hairpin loop secondary structure, as seen in the rho-dependent termination mechanism for transcription in bacteria?
    AAUCGGGUUUCACACAAACCCGAUU
  10. Which of the following statements about promoters is true?
    A promoter serves to indicate which strand is the template strand in the initiation of transcription.
  11. Which of the following statements describes a feature of translation that is unique to eukaryotes?
    The 5' cap and the poly(A) tail are involved in the initiation of translation.
  12. Negative control of gene expression in bacteria generally involves the action of a repressor protein.
    True
  13. One of the consequences of "wobble" in the process of translation is that
    most organisms have fewer than 61 different types of tRNA.
  14. CHECK ALL THAT ARE CORRECT. Which of the following would you expect to find in a bacterial transcription unit for a transfer RNA? (think carefully...)
    B. transcription start site (+1) D.  promoter
  15. During protein synthesis, amino acids are added to the __________ end of the polypeptide.
    carboxyl
  16. Peptide bonds are catalyzed by
    the large subunit of the ribosome
  17. The charging of transfer RNA refers to:
    the formation of a covalent bond between an amino acid and the 3' end of the tRNA.
  18. structural gene regulator protein regulator gene regulatory element
    • Structural gene- genes that are regulated (know that genes aren’t proteins, they have to be DNA)
    • Regulator gene-encodes regulatory proteins
    • Regulatory element- where regulatory protein binds (on ornear promoter)

What would you like to do?

Home > Flashcards > Print Preview