Microbiology - Molecular, Spirochetes, Rickettsia, etc

Card Set Information

Author:
riki3719
ID:
226636
Filename:
Microbiology - Molecular, Spirochetes, Rickettsia, etc
Updated:
2013-07-11 00:10:13
Tags:
Microbiology Molecular Spirochetes Rickettsia
Folders:

Description:
Exam I
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user riki3719 on FreezingBlue Flashcards. What would you like to do?


  1. What are the three steps of traditional and rapid-cycle PCR?
    • Denaturation (melting)
    • Annealing of primers
    • Extension
  2. Different temperatures are required for each step of the PCR cycle. How is this accomplished in real-time PCR?

    A. Each step is performed in a heat block and set at the required temp for the specific reaction
    B. A small chamber is used that can be heated and cooled quickly. The temperatures are easily controlled, shortening the times between each cycle.
    C. Large incubators are used to accomodate multi-welled plates. Plates are moved from one temp to the next to accomplish the multi-step cycle
    B. A small chamber is used that can be heated and cooled quickly. The temperatures are easily controlled, shortening the times between each cycle.
    (this multiple choice question has been scrambled)
  3. Rapid-Cycle PCR decreases the time to detection.

    a. True
    b. False
    a. True
  4. Rapid-Cycle PCR reduces the risk of contamination.

    a. True
    b. False
    a. True
  5. Rapid-Cycle PCR uses Thermal Cyclers that heat and cool quickly.

    a. True
    b. False
    a. True
  6. In Rapid-Cycle PCR, fluorescent detectors are used to measure PCR product.

    a. True
    b. False
    a. True
  7. In contrast to standard PCR, real-time PCR is:

    A. Quantitative
    B. Sensitive
    C. Labor-intensive
    D. Qualitative
    A. Quantitative
    (this multiple choice question has been scrambled)
  8. What is the role of uracil-n-glycosylase (UNG) in molecular diagnostics?

    A. Enzyme used to disassemble protein into its component amino acids
    B. Enzyme used to remove amplicon contamination from PCR
    C. An enzyme that connects nucleotides by catalyzing the formation of phosphodiester bonds
    D. The enzyme used produce short complementary RNAs to prime DNAs
    B. Enzyme used to remove amplicon contamination from PCR
    (this multiple choice question has been scrambled)
  9. Which statements are true of FRET molecular detection probes?

    A. A single probe labeled with 2 fluorophores is used. Excitation occurs when the probe is hybridized to the complimentary nucleotide sequence on the target DNA.
    B. Fluorophores can only be used once since they are quenched in the process.
    C. The FRET hybridization probe system consists of two oligonucleotides labeles with fluorescent dyes. The hybridization probe pair is designed to hybridize to adjacent regions on the target DNA. The donor fluorophore is used to excite the acceptor fluorophore.
    D. During FRET, the acceptor flurophore is excited by an external light source. The light emitted by the acceptor fluorophore can then be detected or measured.
    C. The FRET hybridization probe system consists of two oligonucleotides labeles with fluorescent dyes. The hybridization probe pair is designed to hybridize to adjacent regions on the target DNA. The donor fluorophore is used to excite the acceptor fluorophore.
    (this multiple choice question has been scrambled)
  10. Which statement best explains how Hydrolysis molecular detection probes (Taqman) work?

    A. A quencher and fluorophore are attached to a single probe. Once the probe is hybridized to the target DNA sequence, the polymerase hydrolyzes the probe, releasing the fluorophore. The fluorescent signal can be then be detected over time.
    B. Two probes, quencher and fluorophore labeled, are used. After hybridization of the two probes are attached to their respective regions on the target DNA. Due to their close proximity, the fluorescent signal emitted by the fluorophore probe is quenched. The drop in fluorescent signal is measured over time and used as the means of detection.
    C. A single probe is labeled with 2 fluorophores. Once hybridization occurs, a polymerase is used to hydrolyze the probe. The fluorophore is released and the fluorescent signal it emits is measured. The probe can then be reused cycle after cycle.
    A. A quencher and fluorophore are attached to a single probe. Once the probe is hybridized to the target DNA sequence, the polymerase hydrolyzes the probe, releasing the fluorophore. The fluorescent signal can be then be detected over time.
    (this multiple choice question has been scrambled)
  11. Which of the following is better suited for melting curve analysis?

    a. FRET molecular detection methods
    b. Hydrolysis (Taqman) molecular detection methods
    a. FRET molecular detection methods

    Cannot be reused in Hydrolysis
  12. Describe the concept of quantitation through real-time PCR. Is is possible to quantitate through traditional PCR? Explain.
    • With real-time PCR, it has a very similar procedure as traditional PCR up until the detection stage. Real-time PCR can detect the number of targets produced after each cycle (melting, annealing, extension, measure). The targets are detected with the use of fluorescent probes whcih make the detection stage rapid. The fluorescent measurements are translated into an amplification curve, which are plotted in correspondence to its cycle. This shows a lag phase where the target quantities are low and undetectable, followed by an exponential and plateau phase. The log of each value is plotted or transferred to a log vs. CT value (the CT value being the cycle at which the target numbers entered the exponential phase on our previous graph).
    • This creates a linear line with a decreasing slope because CT value is indirectly proportional to the amount of targets in the beginning. Making this graph with known values, we can use it as a standard curve to compare our acquired CT numbers to and retrieve a quantitative number.
    • Traditional PCR typically uses something such as gel electrophoresis. While we can add molecular weight markers to develop a standard curve, this is not entirely accurate and acts as more of a way to detect the presence of the target vs. how much of it is there. Therefore, it is not possible to quantitate with traditional PCR.
    • The slow process of the detection stage in traditional PCR also allows for more side products that interfere.
  13. Interpret the following sequencing gels

    • #1: GGTACGCCATTGAGCCCATAAGG
    • #2: TTTGCATCCTTATGGGCTCAATG
  14. What is the single most important thing done in molecular diagnostics labs to prevent contamination with post-PCR products?

    A. Changing gloves in between each sample
    B. Unidirectional flow
    C. Mix samples by inverting vs. vigorous vortexing
    D. Using 10% bleach followed by 70% alcohol to clean surfaces
    B. Unidirectional flow
    (this multiple choice question has been scrambled)
  15. Circle all that are true of capillary electrophoresis and correst those that are incorrect.

    a. Lends itself to automates sequencing and automated DNA sequence analysis
    Less labor intensive and allows for higher throughput
    c. The location of the nucleotides is read by lane placement
    d. Fragments synthesized during sequencing are labeled with fluorescent dyes that correspond to their terminal dideoxynucleotide (ddNTP)
    e. Fluorescently labeled DNA fragments are separated according to molecular weight
    All are correct except for - "The location of the nucleotides is read by lane placement" This is form Sanger's method. Read like Flow Cytometry.
  16. Which of the following processes are antibodies responsible for in the immune response?

    a. Opsonizing
    b. Neutralizing
    c. Complement fixing
    d. All of the above
    d. All of the above
  17. Enhanced response due to memory B cells is

    A. An anamnestic response
    B. A primary immune response
    C. A result of the antibodies avidity
    D. A passive immune response
    A. An anamnestic response
    (this multiple choice question has been scrambled)
  18. When reviewing the antibody titers produced during a second instance of the same condition, one would expect to see

    A. A 4 fold increase
    B. A 5 fold increase
    C. A 10 fold increase
    D. A 2 fold increase
    A. A 4 fold increase
    (this multiple choice question has been scrambled)
  19. Which of the following is indicative of a negative complement fixation test:

    A. Hemolysis after 30 min at room temp
    B. No hemolysis after freezing and thawing
    C. Hemolysis after incubation with sheep erythrocytes
    D. No hemolysis after adding guinea pig complement
    C. Hemolysis after incubation with sheep erythrocytes
    (this multiple choice question has been scrambled)
  20. Definition of antigen.

    A. An immunoglobulin produced in response to a foreign substance
    B. Levels are monitored to determine acute and convalescent phases of disease
    C. An immunogen that stimulates an immune response
    D. Serum proteins that attache to foreign substances and enhance phagocytosis
    C. An immunogen that stimulates an immune response
    (this multiple choice question has been scrambled)
  21. Definition of sensitivity.

    A. a and c
    B. The probability that a positive result is a true positive
    C. Percentage of individuals with a specific disease that are correctly identified by the test as having a disease
    D. Measure of how many true events were identified by a measure
    E. A measure of how many non-events are correctly identified
    F. b and d
    g. All of the above
    A. a and c

    Sensitivity = (True Positives)/(True Positives + False Negative)
    (this multiple choice question has been scrambled)
  22. Definition of ELISA.

    A. The resulting "sandwich" is visualized using a fluorescent (UV) microscope
    B. Reaction between a soluble antigen and its antiserum leads to the formation of precipitant
    C. Hemolysis of the indicator cells will occur if an antibody/antigen complex is not formed
    D. Antigens and antibodies absorbed to immobilized surfaces
    D. Antigens and antibodies absorbed to immobilized surfaces
    (this multiple choice question has been scrambled)
  23. Definition of rheumatoid factor.

    A. An antibody derived from a single clone of B cells
    B. Autoantibody directed against IgG
    C. Heterophile antibodies that agglutinate RBCs
    D. Serological test for syphilis
    B. Autoantibody directed against IgG
    (this multiple choice question has been scrambled)
  24. Which of the following is not needed to determine the predictive value of a test?

    A. Disease prevalence
    B. Specificity
    C. Sensitivity
    D. Precision
    D. Precision
    (this multiple choice question has been scrambled)
  25. List 5 infections that are ideally suited to serologic diagnosis.
    • Syphilis
    • Rocky Mountain Spotted Fever
    • Murine typhis
    • Scrub typhis
    • Whipple's disease

What would you like to do?

Home > Flashcards > Print Preview