Chapter 2 RNA

Card Set Information

Author:
kkelley
ID:
268093
Filename:
Chapter 2 RNA
Updated:
2014-03-26 18:04:35
Tags:
Chapter RNA
Folders:

Description:
Buckingham and Flaws - Chapter 2 RNA
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user kkelley on FreezingBlue Flashcards. What would you like to do?


  1. Epigenetics

    What is the RISC?
    The RNA-induced silencing complex mediates the specific interaction between siRNAor miRNA and the target RNA.
  2. RNA Secondary Structure

    Underline two inverted repeats in the following RNA.

    5'CUGAACUUCAGUCAAGCAAAGAGUUUGCACUG 3'
    5'CUGAACUUCAGUCAAGCAAAGAGUUUGCACUG 3'
  3. RNA Processing

    Name three processing steps undergone by messenger RNA.
    Three processing steps of mRNA are polyadenylation, capping, and splicing.
  4. RNA Processing

    What is the function of polyadenylate polymerase?
    Polyadenylate polymerase digests RNAand adds adenines to the 3' end of the transcript.
  5. RNA Processing

    What is unusual about the phosphodiester bondformed between mRNA and its 5' cap?
    The 5' cap is attached by an unusual 5'-to-5' pyrophosphate linkage.
  6. RNA Processing

    The parts of the hnRNA that are translated into protein(open reading frames) are the __________.
    The parts of the hnRNA that aretranslated into protein (open reading frames) arethe exons.
  7. RNA Processing

    The intervening sequences that interrupt protein coding sequences in hnRNA are _____________.
    The intervening sequences that interruptprotein coding sequences in hnRNA are introns.
  8. Gene Expression

    Proteins that bind to DNA to control gene expressionare called __________ factors.
    Proteins that bind to DNA to controlgene expression are called trans factors (or transcription factors).
  9. Gene Expression

    The binding sites on DNA for proteins that controlgene expression are _________ factors.
    Answer: Proteins that bind to DNA to controlgene expression are called cis factors.
  10. Gene Expression
    How might a single mRNA produce more than oneprotein product?
    A single RNA may be alternatively spliced to produce more than one product.
  11. Gene Expression

    The type of transcription producing RNA that is continually required and relatively abundant in thecell is called _____________________ transcription.
    The type of transcription producing RNA that is continually required and relatively abundant in the cell is called constitutive transcription.
  12. Gene Expression

    A set of structural genes transcribed together on onepolycistronic mRNA is called an _________.
    A set of structural genes transcribed together on one polycistronic mRNA is called anoperon.




  13. Using the depiction of the lac operon in Figures 2-9 and2-10, indicate whether gene expression (transcription)would be on or off under the following conditions

    (P = promoter; O = operator; R = repressor): 

    a. P+ O+ R+, no inducer present — OFF
    b. P+ O+ R+, inducer present — ON
    c. P– O+ R+, no inducer present —
    d. P– O+ R+, inducer present —
    e. P+ O– R+, no inducer present —
    f. P+ O– R+, inducer present —
    g. P+ O+ R–, no inducer present —
    h. P+ O+ R–, inducer present —
    i. P– O– R+, no inducer present —
    j. P– O– R+, inducer present —
    k. P– O+ R–, no inducer present —
    l. P– O+ R–, inducer present —
    m. P+ O– R–, no inducer present —
    n. P+ O– R–, inducer present —
    o. P– O– R–, no inducer present —
    p. P– O– R–, inducer present —
    • a. P+ O+ R+, no inducer present — OFF
    • b. P+ O+ R+, inducer present — ON
    • c. P– O+ R+, no inducer present — OFF
    • d. P– O+ R+, inducer present — OFF
    • e. P+ O– R+, no inducer present — ON
    • f. P+ O– R+, inducer present — ON
    • g. P+ O+ R–, no inducer present — ONh. P+ O+ R–, inducer present — ON
    • i. P– O–R+, no inducer present — OFF
    • j. P– O– R+, inducer present — OFF
    • k. P– O+ R–, no inducer present — OFF
    • l. P– O+ R–, inducer present — OFF
    • m. P+ O– R–, no inducer present — ON
    • n. P+ O– R–, inducer present — ON
    • o. P– O– R–, no inducer present — OFF
    • p. P– O– R–, inducer present — OFF
  14. Epigenetics

    Indicate whether the following events would increaseor decrease expression of a gene:

    a. Methylation of cytosine bases 5' to the gene

    b. Histone acetylation close to the gene

    c. siRNAs complementary to the gene transcript  
    a. Methylation of cytosine bases 5' to the gene will decrease expression.

    b. Histone acetylation close to the gene will increase expression.

    c. siRNAs complementary to the gene transcript will decrease expression.
  15. Epigenetics

    How does the complementarity of siRNA to its targetmRNA differ from that of miRNA?
    The complementarity of siRNA is exact.The complementarity of miRNA is imperfect.
  16. Epigenetics

    What is imprinting in DNA?
    DNA imprinting is marking of selectiveareas of DNA usually by methylation.
  17. Epigenetics

    What sequence structures in DNA, usually found 5' to structural genes, are frequent sites of DNA methylation?

    CpG islands are targets for DNA methylation 5' to structural genes.
    CpG islands are targets for DNA methylation 5' to structural genes.
  18. RNA Secondary Structure

    Draw the secondary structure of the following RNA.

    The complementary sequences (inverted repeat) are underlined.

    5'CAUGUUCAGCUCAUGUGAACGCU 3'

What would you like to do?

Home > Flashcards > Print Preview