Ch.7 Nucleic Acid Amplification

Card Set Information

Author:
kkelley
ID:
269361
Filename:
Ch.7 Nucleic Acid Amplification
Updated:
2014-04-05 20:18:54
Tags:
Nucleic Acid Amplification
Folders:

Description:
Buckinham & Flaws Ch.7 Nucleic Acid Amplification Q&A
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user kkelley on FreezingBlue Flashcards. What would you like to do?


  1. A master mix of all components (except template) necessary for PCR contains what basic ingredients?
    Components of a standard PCR reaction mix include dNTPs, oligonucleotide primers, a buffer of proper pH and mono- and divalentcation concentration, and polymerase enzyme.
  2. The final concentration of Taq polymerase is to be0.01 units/µL in a 50 µL PCR. If the enzyme is supplied as 5 units/µL, how much enzyme would youadd to the reaction?

    a. 1 µL
    b. 1 µL of a 1:10 dilution of Taq
    c. 5 µL of a 1:10 dilution of Taq
    d. 2 µL
    Use VCVC to determine the volume of enzyme:

    0.01 x 50 = 5x

    x = (0.01 x 50)/5 = 0.1 µL

    Option b would deliver 0.1 µL enzyme.
  3. Primer dimers result from

    a. high primer concentrations
    b. low primer concentrations
    c. high GC content in the primer sequences
    d. 3' complementarity in the primer sequences
    Primer dimmers occur when primers hybridize to each other at the 3' ends (option d).
  4. Which control is run to detect contamination in PCR?

    a. Negative control
    b. Positive control
    c. Molecular-weight marker
    d. Reagent blank
    A reaction mix with all components except template (reagent blank, d) is used to monitor for contamination.
  5. Nonspecific extra PCR products can result from

    a. mispriming
    b. high annealing temperatures
    c. high agarose gel concentrations
    d. omission of MgCl2from the PCR
    Nonspecific products occur when primers bind to regions other than the intended target (a).

    Omission of magnesium could possibly produce mispriming but more likely will prevent enzyme function.
  6. Using which of the following is an appropriate way to avoid PCR contamination?

    a. High-fidelity polymerase
    b. Hot-start PCR
    c. A separate area for PCR setup
    d. Fewer PCR cycles
    PCR contamination is prevented by physical separation of pre- and post-PCR areas (c).
  7. What are the three steps of a standard PCR cycle? Answer: The three steps of the PCR cycle are denaturation, annealing, and extension.
    The three steps of the PCR cycle are denaturation, annealing, and extension.
  8. How many copies of a target are made after 30 cyclesof PCR?

    a. 2 x 30
    b. 230
    c. 302
    d. 30/2
    PCR is a doubling reaction. Therefore,the number of products after 30 doublings would be 230 (b).
  9. Which of the following is a method for purifying aPCR product?

    a. Treat with uracil N glycosylase.
    b. Add divalent cations.
    c. Put the reaction mix through a spin column.
    d. Add DEPC.
    Spin columns (c) are used to purify PCR products from other components of the reaction mix.
  10. In contrast to standard PCR, real-time PCR is

    a. quantitative
    b. qualitative
    c. labor-intensive
    d. sensitive
    Real-time PCR is quantitative (a).
  11. In real-time PCR, fluorescence is not generated by which of the following?

    a. FRET probes
    b. TaqMan probes
    c. SYBR green
    d. Tth polymerase
    Answer: Tth polymerase (d) does not fluoresce
  12. Examine the following sequence.

    You are devising a test to detect a mutation at the underlined position.
    5' TATTTAGTTA TGGCCTATAC ACTATTTGTG AGCAAAGGTG ATCGTTTTCT GTTTGAGATT
    TTTATCTCTT GATTCTTCAA AAGCATTCTG
    AGAAGGTGAG ATAAGCCCTG AGTCTCAGCT
    ACCTAAGAAA AACCTGGATG TCACTGGCCA
    CTGAGGAGC TTTGTTTCAAC CAAGTCATGT
    GCATTTCCAC GTCAACAGAA TTGTTTATTG
    TGACAGTTAT ATCTGTTGTC CCTTTGACCT
    TGTTTCTTGA AGGTTTCCTC GTCCCTGGGC AATTCCGCAT TTAATTCATG GTATTCAGGA TTACATGCAT GTTTGGTTA AACCCATGAGA
    TTCATTCAGT TAAAAATCCA GATGGCGAAT 3'


    Design one set of primers (forward and reverse) to generate an amplicon containing the underlined base position. 

    The primers should be 20 bases long.
    The amplicon must be 100 to 150 bp in size.

    The primers must have similar melting temperatures (Tm), +/– 2°C.

    The primers should have no homology in the last three 3' bases.

    a. Write the primer sequences 5'→3' as you would if you were to order them from the DNA synthesis facility.

    b. Write the Tm for each primer that you have designed.
    • 5' TATTTAGTTA TGGCCTATAC ACTATTTGTG
    • AGCAAAGGTG ATCGTTTTCT GTTTGAGATT
    • TTTATCTCTT GATTCTTCAA AAGCATTCTG
    • AGAAGGTGAG ATAAGCCCTG AGTCTCAGCT
    • ACCTAAGAAA AACCTGGATGTCACTGGCCA
    • CTGAGGAGC TTTGTTTCAAC CAAGTCATGT
    • GCATTTCCAC GTCAACAGAA TTGTTTATTG
    • TGACAGTTAT ATCTGTTGTC CCTTTGACCT
    • TGTTTCTTGA AGGTTTCCTC GTCCCTGGGC
    • AATTCCGCAT TTAATTCATG GTATTCAGGA
    • TTACATGCAT GTTTGGTTA AACCCATGAGA
    • TTCATTCAGT TAAAAATCCA GATGGCGAAT 3'


    a. 5' AACCTGGATG TCACTGGCCA 3' (forward primer)5' ATGCGGAATT GCCCAGGGAC 3' (reverse primer)

    b. 62ºC (forward primer)64ºC (reverse primer)The product will be 150 bp in length.
  13. How does nested PCR differ from multiplex PCR?
    Nested PCR requires two rounds ofreplication. Multiplex PCR is a single PCR reaction where more than one product is made usingmultiple primer sets.
  14. What replaces heat denaturation in strand displacement amplification?
    In strand displacement amplification, anick in the double-stranded product is used toprime replication, rather than denaturation andprimer binding.
  15. Prepare a table that compares PCR, LCR, bDNA,TMA, Qβ Replicase, and Hybrid Capture with regard to the type of amplification, target nucleic acid,type of amplicon, and major enzyme(s) for each.

What would you like to do?

Home > Flashcards > Print Preview