CBF

Card Set Information

Author:
Cadence
ID:
290998
Filename:
CBF
Updated:
2014-12-08 03:50:17
Tags:
cell biology
Folders:

Description:
CBF
Show Answers:

Home > Flashcards > Print Preview

The flashcards below were created by user Cadence on FreezingBlue Flashcards. What would you like to do?


  1. DNA has a “negatively charged backbone.” What is the structural reason for this negatively charged backbone?
    c. The phosphate groups of the phosphodiester bonds are to the outside.
  2. 2. DNA can be covalently modified by methylation. Where is the CH3 group added to the DNA?
    c. on the C of a CG
  3. If a chromosome has 200 million (200 X 106) base pair of DNA, approximately how manynucleosomes would it have to package this DNA?
    d. 1 X 106
  4. Assume you wanted to construct a functional artificial mammalian chromosome. You have a largepiece of human DNA that you want to grow in a mouse cell line. What features must be included on this human DNA so that it can function as a normal chromosome in the mouse cell line?
    • a. centromere
    • b. replication origin
    • c. telomere
    • e. a, b, and c
  5. The histone proteins that form the nucleosomes have unique structural features that enable them to interact with the DNA? What is this structural feature?
    Positively charged amino acids on N and C tail regions of the proteins that can interact with the DNA.
  6. Select the correct order of chromatin structural organization from less condensed to most condensed.
    DNA, nucleosomes, 30 nm fiber, loops, metaphase chromosome
  7. Eukaryotic chromosomes have many origins of replications (replication origins). What determineswhere these origins of replication form when DNA replication begins?
    A particular DNA sequence
  8. As the replication fork opens up during DNA synthesis, the DNA polymerase on the leading strand
    remains attached and continues synthesizing as the fork opens.
  9. A. ……GAGACTAGTAGGCCTAGGGGTTAGGGGTTAGGGGTTAGGGGTTAGGGGTTA
    B. ……CTCTGATCATCCGGATCC
    Consider the DNA of a chromosome end shown above. DNA synthesis was just completed. Which is the lagging strand, A or B?
    B
  10. A. ……GAGACTAGTAGGCCTAGGGGTTAGGGGTTAGGGGTTAGGGGTTAGGGGTTAB. ……CTCTGATCATCCGGATCC Consider the DNA of a chromosome end shown above. DNA synthesis was just completed. Assume telomerase is active in this cell, what is the consequence of its activity to this DNA as shown?
    the top strand (A) would get longer
  11. RNA polymerase and DNA polymerase are similar enzymes in that they form a ___________ bond by adding nucleotides to the ____________ end of the growing strand (RNA or DNA).
    phosphodiester; 3’OH
  12. During RNA transcription initiation, the first general transcription factor (TFIID) binds to a specific sequence ______________ located in the ______________________ of the gene.
    TATA; promoter
  13. How many RNA polymerase molecules transcribe a given gene (transcription unit) at a given time
    many
  14. The primary RNA transcript is processed to a mature mRNA. During this process a nucleotide is added to the 5’ end of the RNA. What is this nucleotide?
    G
  15. Assume one of the introns in an mRNA was not removed (or not spliced out). What would happenwhen this mRNA (with the extra intron sequences) is translated during the process of protein synthesis?
    • a. nothing, the ribosomes would jump over the intron sequences and start up on the other side.
    • b. the mRNA, including the intron, would be translated but the protein sequence would be different starting at this intron, leading to a longer and different protein being made.
    • e. Both b and d are possible.
  16. Spliceosomes are made of subunits of SNURPS, which are composed of ________ and proteins.The spliceosomes function to break the _______________ bonds of the exon-intron junctions.
    RNA; covelent

  17. What is the +1 nucleotide in the DNA template strand?
    A

  18. How many nucleotides are there in the 5’UTR?
    9

  19. The next tRNA will enter the position #2 called the ____________ site.
    A

  20. What is the anti-codon at the arrow of “Y” of the tRNA in position #1 ?
    CAU

  21. What is the amino acid (at ??) attached to the incoming tRNA that is shown?
    Glu

  22. How many amino acids are there in this polypeptide chain after it is made?
    9

  23. What happens when the codon (* and underlined in the sequence) appears in site #2 of the ribosome?
    a protein factor enters and terminates translation.

  24. What is the end at position labeled “X”?
    N-terminus

  25. When the t-RNA enters site #2 a ______________ bond is formed between the _________ group of the amino acid attached to this tRNA and the carboxyl group that attaches the growing strand to the tRNA in site #1.
    peptide; amino
  26. Where in the cell are the large and small subunits of the ribosomes assembled (that is, actually made)?
    within the nucleolus of the nucleus
  27. The enzymatic activity to make the peptide bond during translation (protein synthesis) is found in the _________________?
    large subunit of the ribosome
  28. Newly made polypeptides must be correctly folded into their tertiary shapes. This process is oftenassisted by proteins called
    chaperones
  29. The first step in most DNA repair mechanisms including mismatch, base excision, and nucleotide excision, is recognition of the DNA damage. In this process, specialized ____________________, recognize ____________________ to initiated DNA repair.
    proteins; distortions in the DNA
  30. Which of the following is involved in determining the level (amount) of a given protein in a cell?
    • a. transcriptional rate of the gene for the mRNA for that protein.
    • b. half-life of the mRNA (for that protein) in the cytoplasm
    • c. half-life of the protein 
    • d. All of the above
  31. An example of a purine base is
    Guanine
  32. Hydrogen bonding always involves a hydrogen atom that is linked to another atom by a
    polar covalent bond
  33. Oxygen, nitrogen, hydrogen, and carbon are the most common elements in biological systems because
    They have unfilled outer electron shells
  34. The formation of polysaccharides, polypeptides, nucleic acids and triglycerides involves a condensation reaction. What molecule is given off in these reactions?
    H2O
  35. A phospholipid contains the following components except which one?
    • a. ribose sugar
    • b. glycerol
    • c. long hydrocarbon fatty acid tails
    • d. phosphorylated polar group
  36. When a carbohydrate is dissolved in water the linear form is in equilibrium with its ring structure. As a result, what can occur?
    The orientation of the OH group on the carbon of the carbonyl can randomly change from up or down on the ring.
  37. Consider the equation for free energy. ∆G=∆H-T∆S. All cellular chemical reactions must be ∆G<0. How is this possible?
    • b. The concentrations of reactants/products can be altered in a metabolic pathway, changing the ∆G.
    • d. Reactions are coupled with highly favorable reactions, making ∆G<0.
    • e. Both b and d
  38. Consider the equation for free energy. ∆G=∆H-T∆S. In the above equation, what is “S”?
    The measure of disorder
  39. An unsaturated triglyceride will have the following characteristics
    One or more double bonds in some of the fatty acid tails
  40. Which of the following is NOT TRUE regarding the production of ATP during glycolysis?
    ATP production takes place by chemiosmotic synthesis.
  41. How is NAD+ regenerated from the NADH produced in glycolysis when there is low or no available oxygen in a eukaryotic muscle cell?
    The pyruvate from glycolysis is reduced to lactate and NADH is oxidized to NAD+
  42. The steps 8 and 9 of glycolysis involve rearrangements of the phosphate group on the 3-carbon compound. At step 10 pyrvuate and ATP are generated. What is the primary reason for these re arrangement steps at steps 8 and 9?
    To make the free energy ∆G<-7.3 for Step 10.

  43. How many carbons does α-ketoglutarate (C) have?
    5

  44. The reaction # ___________ is an oxidation, where _________________ is reduced.
    3; NAD+
  45. In regards to “useable energy” from the citric acid cycle, which of the following is contributing directly to “useable energy.”
    Just the GTP

  46. Which of the following complexes/molecules has the greatest ability to oxidize within the group?
    E

  47. In the diagram, which complexes/molecules can transport or pump H+ across the membrane?
    A, C and E
  48. The source of the NADH for electron transport comes from
    • a. glycolysis
    • b. formation of acetyl Co-A from pyruvate
    • c. Citric acid cycle
    • d. a, b and c
  49. In the final stage of the oxidation of food molecules, a gradient of protons is formed across the inner mitochondrial membrane, which is normally impermeable to protons. If cells were exposed to an agent that causes the membrane to become freely permeable to protons, which of the following effects would you expect to observe?
    The ratio of ATP to ADP in the cytoplasm would fall.
  50. Assume the levels of ATP and NADH increased in the cell. How might the cell response to this increase in available energy carriers?
    The ATP and NADH would down-regulate enzymes in glycolysis or citric acid cycle by an allosteric mechanism, decreasing further ATP and NADH production.

What would you like to do?

Home > Flashcards > Print Preview